|
| |
• FREQUENTLY ASKED QUESTIONS
|
- Where is the PAN Facility located/contact info?
- What is the turnaround time?
- What is the deadline for sample submission?
- How much does it cost?
- What primers does the PAN Facility provide?
- What concentration should the DNA be?
- Why do the results look bad?
- Why can’t I download my results?
- Why can't I access the website (unable to log-in)?
1. Where is the PAN Facility located/contact info? (top)
We are located in the basement of the Beckman Center, B017. We also have a drop-off area in the cold room B024.
Phone: (650) 723-3189
Email: dnaseq@cmgm.stanford.edu
Shipping Address:
PAN Facility - DNA Sequencing
Beckman Center, B017
279 Campus Drive, West
Stanford, Ca 94305
2. What is the turnaround time? (top)
When samples are dropped off by the deadline (see below), results are available for download by noon the following business day. Data can be downloaded from our website under our "Status of Order" webpage. Please contact us if you are running behind, we can usually wait for you. Also, contact us if you can not find or download your data. dnaseq@stanford.edu or 650-723-3189.
3. What is the deadline for sample submission? (top)
For Reaction NOT Complete -Drop-off deadline is 12:00pm.
For Clean-up - Drop-off deadline is 2:00pm
For Run Only - Drop-off deadline is 3:00pm
Please contact us if you're running late, we can usually wait.
4. How much does it cost? (top)
Please check our current price list.
5. What primers does the PAN Facility provide? (top)
|
5’- TGTAAAACGACGGCCAGT -3’ |
|
5’- CAGGAAACAGCTATGACC -3’ |
|
5’- TAATACGACTCACTATAGGG -3’ |
|
5’- ATTAACCCTCACTAAACCCA -3’ |
|
5’- ATTTAGGTGACACTATAG -3’ |
6
. What concentration should the DNA be? (top)
|
Concentration |
Volume (for 2 rxns) |
|
100ng/ul |
10ul |
|
20ng/ul |
10ul |
|
0.5ug - 1.0ug/ul |
16ul |
|
10pmol/ul (10uM) |
2ul |
*For custom primer, please premix template and primer prior to submission.
7. Why do the results look bad? (top)
There are a few reasons for “bad” data. Please go to our webpage "Data Analysis" to find the cause and cure for bad data. Remember most reruns and resequences are free.
8. Why can't I download my data? (top)
One reason maybe that there is a typo when creating the links, or the data has not finished downloading onto the server. Please contact us immediately if you are unable retrieve your results at dnaseq@stanford.edu or 650-723-3189. If the server is down we will email you your data.
9. Why can't I access the website (unable to log-in)? (top)
The server might be down. Please contact us right away if you are having any problems logging into our website. If you are trying to submit an order you can print out our DNA Sequencing Request Form (word or pdf) and submit this form with your samples, and we will enter the information into our database for you.
|