Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1
Characteristics of the secondary structures
Terminator: Distance from promoter:114 nt. Distance to gene:74 nt. Distance to run of Ts=0 nt. Size=24 nt. Delta G= -8.30 kcal/mol
Antiterminator: Distance from promoter:79 nt. Size=41 nt. Delta G= -5.80 kcal/mol
Anti-antiterminator: Distance from promoter:49 nt. Size=51 nt. Delta G= -3.90 kcal/mol
Nomenclature/Definitions
The most likely promoter is: atgaat-tatttt. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
atgaatcaaataaatgaatattttatttttatataaataaatcaaatatttagatatttattatttttaattaaagctagttttttcaaaaaaatgtgtc
taactctacgcttttgtatcaaaaagattcattttgcgacaaaaaagtggagtaaaagctctatttttttttaaataacctctttaatatttgcattgaa
aggatactcctgaactaaaaaaagtcgatcaaaggaatacataagATG
ACIAD0008
Gene: ACIAD0008 GI: 50083305 BI number: ACIAD0008 GOG: ------- Description: putative RND type efflux pump involved in aminoglycoside resistance (AdeT
ac
a t
t c
c t
ta
gc tt
tg a c
gc g a
t t at
at at
at at
at at
| g | g
a t a c
a a cg aa
a t ta a a
a c a c tg
c a t a gc
ta g a at
ta ta gc
ta ta gt
ta ta ta
tg ta gt
ta cg at
gt gt at
at cg at
tttttaaataacctctttaatatttgcattgaaaggatactcctgaactaaaaaaagtcgatcaaaggaatacataagATG
..................................................................................................................