Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -5.02 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTGAGCAGCGCCCAATTGTGGGACATATGATTGAATTTGAAGATAAAGCCAAAGCC
ACCTTGTTTGGTGTAGTGAAATCAGTCAACGACGATATTACCGAGATTGATTTTAACC
ATCCATTGGCGGGAAAAAACATTGCGTTTGAAGTTGAAATCTTTAAGGTCACCCCTGC
TGGGCAGCAAGGCGTGAAATTAATGTAAtacaaaaagctctcatcggagagctttttttaagcttgaaaataagtataa
gatggtcaaaagcaaagcaatatatcaataaaacacaggataatcatATG

    ACIAD0019


Gene: ACIAD0019     GI: 50083314     BI number: ACIAD0019     GOG: COG0431     Description: conserved hypothetical protein; putative flavoprotei


            A
          A  T
          A  T
          G  A
           TA
           GT
           CG
           GT
          |  A
          |  A
          |  t
          |  a
          |  c
          |  a
          |  a
 GG       G  a
G  C      A  a
 TA       A  a
 CG        Cg
 GC        Gc        tc
 TA        At       a  g
C  A      C  |       cg
 CG        Gc        ta
 CG        Gt        cg
|  C       Gc        ta
 CG        Ta        cg
 AT       C  t       gc
 CG        Gc        at
 TA        Tg        at
                        tttttaagcttgaaaataagtataagatggtcaaaagcaaagcaatatatcaataaaacacaggataatcatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0431 Predicted flavoprotein ... can be seen here

    ..................................................................................................................