                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCGGATTATCGTGATTATAATCTGCCAAGACCAGGGCGTGGTCAACAGTGGTACAA
GATTAATAATGATTTTATTCTGGTCAATTCAGACAGCAACGACATTATACGTATTCTG
AATTTTTAAgctgagtcagtgacatgtttagcccgattaaaatatcgggcttttttatatgtcaagtgagcctacatcttttgttcactaactt
cacaatttgataactcacctccattatatatcttaagttattcattacattggttttatcaaagatagatatgatataaacgaggcaaaaATG

    ACIAD0040 Gene: ACIAD0040     GI: 50083334     BI number: ACIAD0040     GOG: COG5455     Description: conserved hypothetical protein; putative signal peptid TT A  A C  T A  A GC CG AT A  A C  T G  | A  | C  | AT GC AT CG TA TA AT AT C  T T  T G  T G  A TA        ga Cg       t  c       aa T  c      g  a      a  a T  t       at       t  t A  |       cg        ta T  |      t  |       at Tg        gt        gc Ta        at        cg Tg        gt        cg At        ta        cg Gc        cg        gc Ta        gc        at                         tttttatatgtcaagtgagcctacatcttttgttcactaacttcacaatttgataactcacctccattatatatcttaagttattcattacattggttttatcaaagatagatatgatataaacgaggcaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5455 Predicted integral membrane protein ... can be seen here     ..................................................................................................................