                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:88 nt.    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.70 kcal/mol
Antiterminator:    Distance from promoter:68 nt. Size=36 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:    Distance from promoter:67 nt.    Size=21 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatc-tagcct. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatcatgtaaccaagaaaatgtagcctatagctcgatttatccatcatttatctctcaaatataatttgatcagagataaatttttaataaacagaaa
gtataaaacttactttcctgtaagttgtattttgattacggcatacagctttttaaataaaatataagcttacttccaagggtccaagATG

    ACIAD0098 Gene: ACIAD0098     GI: 50083388     BI number: ACIAD0098     GOG: COG2148     Description: putative UDP-glucose lipid carrier transferase/glucose-1-phosphate transferase in colanic acid gene cluster (WcaJ            tc           t  c           t  t            cg         t            at       t  g            ta       t  a            ta       t  t            cg        at   a        at        ta a  a      a  |       gc a  c      a  |       tg t  t       at        tg at        tg        gc ta        at       a  a gc        ta        at at        gt        ta at        at        gc at        at        ta gc        at        cg                         ctttttaaataaaatataagcttacttccaagggtccaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2148 Sugar transferases involved in lipopolysaccharide synthesis ... can be seen here     ..................................................................................................................