                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCAGGTCGATACCCTGCGTGAAGATTATGCCATCTATCTGGTTCGTAGTGGCCGTA
TTTGTGTTGCGGGTTTAAACATGAATAATGTCTATATTGTAGCCAAAGCGATGGCTGA
AGTATTAGCCACCGAAGTGACTCCTGCTTAAgattatcctacacaacgccagttgtactttagaaattttacaaagt
cataactggcttctttcaatattgtcttttttgttacagagcctcactattttttttgaatatattaaatttaaataaagtcaattacttaataatttca
ggtcataATG

    ACIAD0111 Gene: ACIAD0111     GI: 50083401     BI number: ACIAD0111     GOG: NOG14976     Description: conserved hypothetical protein; putative membrane protei             t           a  t           a  t           a  t           g  a           a  c            ta            ta            ta            cg            at           |  c            ta            gt cc        ta g  a       ta cg        gc at        at at        cg cg        cg at        gc             ttctttcaatattgtcttttttgttacagagcctcactattttttttgaatatattaaatttaaataaagtcaattacttaataatttcaggtcataATG     ..................................................................................................................