                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=63 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCTTTTAAGCGGAAGTGCGGGGAGTTCAGCATTGGTTTTTAATAATGGAATTGCCA
CCACAGCGAAGCAAGCGACTGCATCGGGTACTGCAACTTACAATATGACAGCGCAATA
CTATGCAAAAGGTAAAGTTGAAGCAGGTACTGTAACAGCAGTTGCTGATTACGAAGTT
ATTTATCCTTAAcggatttttaatgatccgccatgtgctctgtataggatgacatggcgtttttgacaaaatacaagaaaaggataaaacg
tgaaaaaagcatctaaattctggtcaagtgtgctgATG

    ACIAD0120 --- ACIAD0121 --- ACIAD0122 --- ACIAD0123 Gene: ACIAD0120     GI: 50083409     BI number: ACIAD0120     GOG: COG3121     Description: putative pili assembly chaperone, required for type 1 fimbriae Gene: ACIAD0121     GI: 50083410     BI number: ACIAD0121     GOG: COG3188     Description: putative outer membrane usher protein (probable fimbrial usher protein) Gene: ACIAD0122     GI: 50083411     BI number: ACIAD0122     GOG: NOG05555     Description: putative fimbrial subunit, outer membrane protein Gene: ACIAD0123     GI: 50083412     BI number: ACIAD0123     GOG: -------     Description: putative pili assembly chaperon   A A  T C  A G  C C  T G  A AT CG A  | GC TA A  A T  A A  A A  G CG AT |  A TA TA CG AT AT CG                  GT |  A                A  T |  A                 CG |  G                 GC |  C                 AT G  A       AC        CG TG       A  A      |  A CG        TG        AT AT        GC        AT TA        TA        TA GC        CG        GC GT        AT        TG                         AAGTTATTTATCCTTAAcggatttttaatgatccgccatgtgctctgtataggatgacatggcgtttttgacaaaatacaagaaaaggataaaacgtgaaaaaagcatctaaattctggtcaagtgtgctgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NU] COG3121 P pilus assembly protein, chaperone PapD ... can be seen here [NU] COG3188 P pilus assembly protein, porin PapC ... can be seen here     ..................................................................................................................