                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:159 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -7.76 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTGAATGAGATGTAATACTAGGAGCTTCATCCGACCCGCTTCAAATAGACGCCCA
CGACGGCCTGAATGGTGATGCTCTCGATGCTGTAAATCCTGTTCAGGTTGATGATGAC
TGGATCGATGTCTCATctttattttctcatattgcttaatttagatatattaagatatatcttagtatatcttttagcaagttaagat
attacttatagttaaaattagtattgacttcatctaataattcattaatttaaatataaaaattattaacttataatcatttcaataggaattagcATG

    ACIAD0152 Gene: ACIAD0152     GI: 50083438     BI number: ACIAD0152     GOG: COG4694     Description: conserved hypothetical protei CG A  A        C C  C      T  C CG       A  T CG       A  G GC       A  T |  C      T  T C  T       GC A  G       TA G  A       CG A  A      G  | T  T       TG A  G       AT         T A  G       GT       A  C AT        CG       G  G CG        TA       G  A TA       C  T      T  T T  T      T  G       CG CG       C  |       AT GC       G  |       GC C  T       TA       T  | C  C       AT        AT C  |      G  G       GC AT        TA        TA GC        GC        AT CG        GT        Gc                         tttattttctcatattgcttaatttagatatattaagatatatcttagtatatcttttagcaagttaagatattacttatagttaaaattagtattgacttcatctaataattcattaatttaaatataaaaattattaacttataatcatttcaataggaattagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4694 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................