                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGCTGATATTCAGGATGTTTCCAAACGTATCGCATTCAAAGTGGCGAAGGCTGCCA
TTGAAGATGGTGTGGCATTGAATATGAGTGATGAGGTGCTGTTACAGAATATTGAAAA
AGAGTTCTGGAAACCCAAATATCGTGGTTATAAACGTGTTCCGTTTTAAtccataatttaaaaa
aaagagcttcggctcttttttttttggaaaaaagataacaaagcctatagacgggactgtctgtattttttaaaatttgtagacaatgtatttcaataaa
attaaaaatgaataaagctgATG

    ACIAD0167 --- ACIAD0168 --- ACIAD0169 Gene: ACIAD0167     GI: 50083452     BI number: ACIAD0167     GOG: -------     Description: conserved hypothetical protein; putative VGR-related protein Gene: ACIAD0168     GI: 50083453     BI number: ACIAD0168     GOG: -------     Description: hypothetical protein Gene: ACIAD0169     GI: 50083454     BI number: ACIAD0169     GOG: -------     Description: hypothetical protein; putative signal peptid            at           c  a           c  a           t  t            At            At            Ta   T        Ta G  T       Ta T  C       Ta GC       |  a CG       |  a       tc AT       G  a      t  g AT       C  a       cg AT        Cg        gc T  T       Ta        at A  A       Tg        gc T  A       Gc        at T  t      |  t       at Gc       T  t       at Gc        Gc        at Ta        Cg        at                         tttttggaaaaaagataacaaagcctatagacgggactgtctgtattttttaaaatttgtagacaatgtatttcaataaaattaaaaatgaataaagctgATG     ..................................................................................................................