Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G= -7.79 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATTAATCGATAAGAATTATAATTTAACTTATATGGAAGGTAATAAAGAAAAGCGAAT
ACAGTTGAAATAAtagttgtattcatattttgataagtgattgaaatcaatccgaacttaaaaaagttcggattttttacaaatataaaaa
ctaaggagaaatgtttacataggcactgatttagttgatattgcataatggggcgggattaactatgtctaaaaaatattatcaattggtattattttga
tcaagttaaggctgagcaaaatgtgaaaatttaagttgataacttataaatGTG

    ACIAD0171


Gene: ACIAD0171     GI: 50083455     BI number: ACIAD0171     GOG: -------     Description: hypothetical protei


 AT
A  A
A  A
 Gt
 Ta
T  g
G  t
 At
 Cg
 At
 Ta
 At
 At
 Gc
C  a
G  t
A  a
 At
 At
 At
 Gt
A  g
A  |
A  |
T  |
A  |
A  |
T  |       aa
G  |      a  t
G  |       gc
A  |       ta        aa
A  |       ta       a  a
G  |       at        ta
G  |       gc        ta
T  |      |  c       cg
A  |      |  g       at
 Ta       |  a       at
 At        ta        gc
 Ta        gc        cg
 Ta        at        cg
 Cg        at        ta
 At        ta        at
                        tttttacaaatataaaaactaaggagaaatgtttacataggcactgatttagttgatattgcataatggggcgggattaactatgtctaaaaaatattatcaattggtattattttgatcaagttaaggctgagcaaaatgtgaaaatttaagttgataacttataaatGTG


    ..................................................................................................................