                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:41 nt. Size=33 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:    Distance from promoter:8 nt.    Size=47 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TACGGT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGCCATGACCGATTTTTATTGTACGGTGATACAGGGGTTGACCATGCAAGCACG
TGATGGTGCCTCACTTGCGCAATTGACCAAGGTGGTTGAGCATGCAATGCGTGCTTGG
TCTTTATTTGTAGATACACATGGCGAGACTACGATATAAatgtccgaaatacgatattttaatttcaaccg
tcattgagcacaatttaatgatctaggctgtagcggaagtaatatATG

    ACIAD0197 Gene: ACIAD0197     GI: 50083479     BI number: ACIAD0197     GOG: COG0697     Description: putative membrane protei   T G  G G  C T  C                  A AT                 A  T GC                  CG TA                  GC GC                  TG C  T                 AT AT         G        CG CG       A  G       GC GC       A  T       AT A  |       CG       G  | A  |       CG       T  | CG        AT       T  | GC        GT       G  | TA        TG       G  | A  A       TA       T  | C  |      A  G      G  | C  |      A  C      G  | AT       C  A      A  | GT        GT        AT TG        CG        CG TA        GC        CG GC        TA        AT GC        TA        GC                         TTTATTTGTAGATACACATGGCGAGACTACGATATAAatgtccgaaatacgatattttaatttcaaccgtcattgagcacaatttaatgatctaggctgtagcggaagtaatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................