Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:87 nt.    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.60 kcal/mol
Antiterminator:    Distance from promoter:56 nt. Size=44 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:    Distance from promoter:20 nt.    Size=54 nt.     Delta G= -4.57 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtta-taagtt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttatgcataaatatttctgaattttaagtttaaaaaacaaacaagttaattgttatttcattgtttttacactatttataatcctaaaaaatgaatg
aaattcatgttaaaatgatcggctttcatctttgatgtcagccttctttttattcagcaagccgagaaTTG

    ACIAD0220


Gene: ACIAD0220     GI: 50083500     BI number: ACIAD0220     GOG: COG1032     Description: conserved hypothetical protei


 ta
t  t
t  a
a  a
t  t
c  c
a  c       ta
c  t      t  a
a  a      g  a
 ta        ta
 ta        at
 ta        cg
 ta        ta
 ta       t  t
 gt       a  c
|  g      a  g
 ta       a  g        t
 ta       g  c      t  t
 at       t  t       cg
 cg        at        ta
 ta        at        at
 ta        gc        cg
 ta        ta       t  t
 at        at       t  c
t  t      a  c       ta
t  |       at        cg
 gc        at        gc
 ta        at        gc
                        ttctttttattcagcaagccgagaaTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG1032 Fe-S oxidoreductase ... can be seen here

    ..................................................................................................................