                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:137 nt.    Distance to gene:68 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-14.00 kcal/mol
Antiterminator:    Distance from promoter:108 nt. Size=45 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:105 nt.    Size=15 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAAA-TACAAT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAAATAGAAGGTGTATTGGCTACAATTGCATATAGTGCTGTGTTGACCTTTATTAT
CTTGAAAGTCATTGATGTCGTGATTGGAATTCGTGCTAACTCTGATGATGAGCGTATG
GGTCTCGATTTGAGCCAGCATGGCGAACGTGTAGAATAAttattgagttctttaaaaaacagccgatcagg
ctgtttttttatggcgttttgtggtcgagattctgtaagcgtttaaattttgctacactagcttaaataaatgaattcatttgagctgccATG

    ACIAD0246 --- ribD --- ACIAD0248 Gene: ACIAD0246     GI: 50083524     BI number: ACIAD0246     GOG: COG1327     Description: putative transcriptional regulator, consists of a Zn-ribbon and ATP-cone domains Gene: ribD     GI: 50083525     BI number: ACIAD0247     GOG: COG1985,COG0117     Description: bifunctional protein [Includes: diaminohydroxyphosphoribosylaminopyrimidine deaminase (Riboflavin-specific deaminase); 5-amino-6-(5-phosphoribosylamino)uracil reductase (HTP reductase) ] Gene: ACIAD0248     GI: 50083526     BI number: ACIAD0248     GOG: COG3392     Description: putative DNA modification methylase (Adenine-specific methyltransferase             a           t  t           t  t           A  g           A  a            Tg         t            At       a  c            At       g  a            Gc        cg            At        cg           T  t       gc            Gt        at            Ta        cg           |  a       at           |  a       at           G  a       at   G       C  a       at C  A      A  a       at G  A      A  c       at GC       G  a      |  t TG        Cg       t  a AT        Gc       t  t CG        Gc        tg GT        Tg        cg                         cgttttgtggtcgagattctgtaagcgtttaaattttgctacactagcttaaataaatgaattcatttgagctgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1327 Predicted transcriptional regulator, consists of a Zn-ribbon and ATP-cone domains ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0117 Pyrimidine deaminase ... can be seen here [L] COG3392 Adenine-specific DNA methylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:144 nt.    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-11.00 kcal/mol Antiterminator:    Distance from promoter:106 nt. Size=45 nt.     Delta G= -5.60 kcal/mol Anti-antiterminator:    Distance from promoter:105 nt.    Size=15 nt.     Delta G= -3.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTCAAA-TACAAT. It has a score value of 66.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTCAAATAGAAGGTGTATTGGCTACAATTGCATATAGTGCTGTGTTGACCTTTATTAT CTTGAAAGTCATTGATGTCGTGATTGGAATTCGTGCTAACTCTGATGATGAGCGTATG GGTCTCGATTTGAGCCAGCATGGCGAACGTGTAGAATAAttattgagttctttaaaaaacagccgatcagg ctgtttttttatggcgttttgtggtcgagattctgtaagcgtttaaattttgctacactagcttaaataaatgaattcatttgagctgccATG     ACIAD0246 --- ribD --- ACIAD0248 Gene: ACIAD0246     GI: 50083524     BI number: ACIAD0246     GOG: COG1327     Description: putative transcriptional regulator, consists of a Zn-ribbon and ATP-cone domains Gene: ribD     GI: 50083525     BI number: ACIAD0247     GOG: COG1985,COG0117     Description: bifunctional protein [Includes: diaminohydroxyphosphoribosylaminopyrimidine deaminase (Riboflavin-specific deaminase); 5-amino-6-(5-phosphoribosylamino)uracil reductase (HTP reductase) ] Gene: ACIAD0248     GI: 50083526     BI number: ACIAD0248     GOG: COG3392     Description: putative DNA modification methylase (Adenine-specific methyltransferase             t           A  t           A  a           T  t           A  t            Ag            Ga            Ag            Tt            Gt           T  c            Gt            Ct           |  t        t           |  a      a  c           A  a      g  a   G       A  a       cg C  A      G  a       cg G  A      C  a       gc GC       G  a       at TG        Gc        cg AT        Ta        at CG        Ag        at GT        Cc        at                         ttttatggcgttttgtggtcgagattctgtaagcgtttaaattttgctacactagcttaaataaatgaattcatttgagctgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1327 Predicted transcriptional regulator, consists of a Zn-ribbon and ATP-cone domains ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0117 Pyrimidine deaminase ... can be seen here [L] COG3392 Adenine-specific DNA methylase ... can be seen here     ..................................................................................................................