Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G= -5.89 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATTTAAAAAAGACACTTATTCCTGAGTATATAAAAAATAAAATTATAGAGATAGAA
AATAATGTTAATCATCCGATTGTCTTTTCTGAGTGAtgttatttaagtcaaacttaagttttgtataaataat
gaaagtaatgaatcaaatcgatttatttaaataaatcgatgttttaagatgttgtgattacttgattattcaaagcaatataaatagtattgctttgaat
ttaattcaaagaattatttttttatttgtctgtcgtctaaaagtttttttaaatcggagtgggttctaaATG

    ACIAD0291


Gene: ACIAD0291     GI: 50083565     BI number: ACIAD0291     GOG: -------     Description: putative DNA binding protei


  a
c  a
t  a
 gc
 at
 at
 ta
 ta
 tg
 at
t  t
t  t
 gt
 tg
 At
|  a
|  t
G  a
T  a
G  a
A  t
G  a
T  a
C  t        a        ta
 Tg       a  t      t  a
 Ta       a  c       ta
 Ta        cg        at
 Ta        ta        ta
 Cg        at        ta
T  |       at        ta
 Gt        gt        at
 Ta        ta        gc
 Ta        at        cg
 At        at        ta
                        tgttttaagatgttgtgattacttgattattcaaagcaatataaatagtattgctttgaatttaattcaaagaattatttttttatttgtctgtcgtctaaaagtttttttaaatcggagtgggttctaaATG
    ..................................................................................................................