                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCCTGATACTCGCAATTGATCAATTTTTAGATATGGGACGTACCGCGACGAATGTTG
TCGGTAATAGTATTGCAACAGCAGTGATTGCGAGAACGACACCAATGGAAGAGTTAAA
GCCAGAAACGAATATGGAAGACGTTCAACAGATGGTGAACACTTCGCAACAAAGTGCC
TAActcagtttttaactaggacaaaagaaagtagcttagttggagttactttcatttttatgcaattgttgatcctagccaaaataatggacagtact
tccctctaaagataacgtaacgttaactTTG

    ACIAD0320 --- ACIAD0321 Gene: ACIAD0320     GI: 50083591     BI number: ACIAD0320     GOG: -------     Description: transposase for IS1236, orf1 Gene: ACIAD0321     GI: 50083592     BI number: ACIAD0321     GOG: COG2801     Description: transposase for IS1236, orf ag a  a        t a  a      g  t a  a      a  g cg        tg at        ta |  a       cg |  g       gt gc        at gt        ta at        gc ta        at cg        at at        at at        gc             atttttatgcaattgttgatcctagccaaaataatggacagtacttccctctaaagataacgtaacgttaactTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2801 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................