                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-23.50 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGCTTTAATTGGAGGTATCGCAGGTAAAGTCTATTCCAAGCGCTGTGCCAAAGCAT
AAtgggtcatgcatattgaaccaagcgaacaattagaccaattgcggctcagggtatgttatatcatgctatctgggccgcatttttactttggcgcaa
ccaatgtttggttaaaaaaccaattgttttagattaaaagacacttatcttattaaatttactttattttgttgtatacacttgattttataagtgaaaa
caataacagttgtcacatcatcttcataataatgaatttttacATG

    ACIAD0324 Gene: ACIAD0324     GI: 50083594     BI number: ACIAD0324     GOG: -------     Description: hypothetical protei                      at             a       t  a           g  c      t  t           a  c       gc            ta        ta            ta        at            at        tg            at        gc            cg        gt           a  c      |  a   a       a  g      |  t c  t      g  |       gc g  a       cg        at t  t       gc        cg at        at        tg cg       |  c       cg ta       |  a       gc g  a      a  g       gc gc        cg        cg gc        cg        gc ta        at        ta                         tttttactttggcgcaaccaatgtttggttaaaaaaccaattgttttagattaaaagacacttatcttattaaatttactttattttgttgtatacacttgattttataagtgaaaacaataacagttgtcacatcatcttcataataatgaatttttacATG     ..................................................................................................................