                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:39 nt.    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.80 kcal/mol
Antiterminator:    Distance from promoter:25 nt. Size=20 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-AATCTT. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGTGGTTTCTCATGCTTGGAATCTTTTTCCTGATTTTTGTACGTCCTTATGTGT
TTTAAaatttaaacgcccaatagggcgtttttttttgagatgtaaaaaagcataatagggtgtagatgtgatgtgtatcacgttgttttaaatttgt
tacaactattaaaattgaattaagtattttagctctaaaatggctcggtttttgagaagtggttattttagataggttcaacaATG

    ACIAD0339 Gene: ACIAD0339     GI: 50083604     BI number: ACIAD0339     GOG: -------     Description: hypothetical protei aa        at A  t      a  a A  t       cg T  t       cg Ta        cg Ta        gc Ta        cg Gc        at Tg        at Gc        at             ttttttgagatgtaaaaaagcataatagggtgtagatgtgatgtgtatcacgttgttttaaatttgttacaactattaaaattgaattaagtattttagctctaaaatggctcggtttttgagaagtggttattttagataggttcaacaATG     ..................................................................................................................