Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:41 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=78 nt.     Delta G=-16.22 kcal/mol
Anti-antiterminator:   Size=80 nt.     Delta G=-22.86 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGATTACCAAACACCGTGCCAAACGTGATAAACGTCGTGCCGGCTCGGTTTTAGAAG
TAATTCCAGGATTAGGGCCTAAGCGTCGTCGTGACTTATTGACTCATTTTGGTGGTAT
CCAGGGTGTACTCAAAGCTTCGGAAAAGGAGCTGATGCTGGTTTCTGGTCTGGGGCCT
TCTATGGCAAGAACCATTTATAAAATCTTGCATGAATAAattggcaaaaacatcctgtgactggcgcgtca
ctgatcatttttgttgtcataaaatactgcacaatagcaatcagaatgaaaaataATG

    ACIAD0341


Gene: ACIAD0341     GI: 50083606     BI number: ACIAD0341     GOG: -------     Description: putative acyl-CoA thioesterase I


            T
          T  A
          T  T
 TG       A  A
A  C      C  A
G  T      C  A
 TG       A  A
 CG        AT
 GT        GC
 AT        AT
 GT        AT
 GC        CG
 AT        GC
A  G      |  A
A  G      |  T
 AT       |  G
 GC       G  A
 GT        TA
 CG        AT
 TG        TA
 TG       |  A
 CG       C  a
 GC       T  t
|  C      T  t
A  T       Cg
A  T       Cg
A  C       Gc
C  T      |  a
T  A      |  a
C  T      |  a
A  G      |  a
 TG       |  a
 GC       |  c
 TA       |  a       gc
G  A      |  t      g  g
G  |       Gc       t  c
G  |       Gc        cg
A  |       Gt        at
C  |       Tg        gc
 CG       |  t       ta
 TA        Cg        gc
A  |       Ta       t  t
 TA        Gc       c  |
 GC        Gt        cg
 GC        Tg        ta
 TA        Cg        at
                        catttttgttgtcataaaatactgcacaatagcaatcagaatgaaaaataATG


    ..................................................................................................................