                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-17.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -4.34 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAACAGAACAGCCTCTTACCTTTGAAACGCATGTTCCTGAGCGCATGGAAATCATTT
CAGGCGAATGCCGCGTCAAGATTGCAGACAGCACAGAAAGTGAATTGTTCCGTGCAGG
CCAGTCTTTTTATGTGCCTGGCAACAGTTTATTTAAAATCGAAACAGATGAAGTGCTC
GATTACGTTTGTCATTTAGAAGGCTAActcttcggctgttaaatcagttaaaatagttgtgttaaaaatcctgtgaagct
ggctttacaggattttattttttatatgcggttttagaggttaaacATG

    ACIAD0357 Gene: ACIAD0357     GI: 50083619     BI number: ACIAD0357     GOG: COG0566     Description: putative tRNA/rRNA methyltransferas            ta           t  a aa       g  a t  a      t  a t  t      g  a       tg gc       t  t      c  g ta       t  c       gc cg        gc        at gt        at        at g  t       tg        gt c  a       at        ta ta       a  g       gc ta       a  a       ta |  a      a  |       cg c  t       ta        cg ta        tg        ta cg        gc        at At        at        at At        cg        at Tg        tg        at                         attttttatatgcggttttagaggttaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0566 rRNA methylases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.70 kcal/mol Antiterminator: Size=39 nt.     Delta G= -4.34 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G= -7.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CCAACAGAACAGCCTCTTACCTTTGAAACGCATGTTCCTGAGCGCATGGAAATCATTT CAGGCGAATGCCGCGTCAAGATTGCAGACAGCACAGAAAGTGAATTGTTCCGTGCAGG CCAGTCTTTTTATGTGCCTGGCAACAGTTTATTTAAAATCGAAACAGATGAAGTGCTC GATTACGTTTGTCATTTAGAAGGCTAActcttcggctgttaaatcagttaaaatagttgtgttaaaaatcctgtgaagct ggctttacaggattttattttttatatgcggttttagaggttaaacATG     ACIAD0357 Gene: ACIAD0357     GI: 50083619     BI number: ACIAD0357     GOG: COG0566     Description: putative tRNA/rRNA methyltransferas TA T  G T  A A  A CG TG GC T  T       aa TA       a  t TA       a  a Gc       t  g C  t      t  t A  c      g  t T  t      a  g T  |       ct At        tg        tg Gc        at       c  g Cg        at        gc T  |      a  a       at Cg       t  a       at Gc       t  |       gt T  t       ga        ta G  g       ta        gc A  |       ca        ta At        gt        cg Gt        gc        cg Ta        cc        ta                         ttttattttttatatgcggttttagaggttaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0566 rRNA methylases ... can be seen here     ..................................................................................................................