Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1
Characteristics of the secondary structures
Terminator: Distance to gene:186 nt. Distance to run of Ts=0 nt. Size=37 nt. Delta G=-14.90 kcal/mol
Antiterminator: Size=36 nt. Delta G= -5.10 kcal/mol
Anti-antiterminator: Size=35 nt. Delta G= -3.50 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ATTCAATAAACGCTTTAGCCGTTTCAAACGTTAAtttttccttaagtttattcatctaaacttattgtattggaa
gcctatggaactatctcctccacctgggcttctttttttgtctacattttctttataccgtctgtgtataaagcttaagttatccacaatctcaaagatt
tcattttagttttattcatctgcatgattttctgattcatttttcatcgtctttcaggcggatatcgccccattcaatggtatgcttgatcctacttttg
atatgcaattgaatgacggaaccccATG
ACIAD0424
Gene: ACIAD0424 GI: 50083678 BI number: ACIAD0424 GOG: NOG44487 Description: putative type III effector HopPma
ca
cc t t t
c A t c a c
c T at t t
a G ta c c
at ta a c
gc ta at
gc gc gc
| t at gc
| t at ta
| a ta | c
| a | t | c
cg | t at
at | g tg
| t | t cg
gt | a cg
ta | t gc
at t t at
at cg at
gc cg gc
ta ta gt
ttttttgtctacattttctttataccgtctgtgtataaagcttaagttatccacaatctcaaagatttcattttagttttattcatctgcatgattttctgattcatttttcatcgtctttcaggcggatatcgccccattcaatggtatgcttgatcctacttttgatatgcaattgaatgacggaaccccATG
..................................................................................................................