                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTAAAGCTACGGCAAAATCGGCACCTAAAGAGACCAGTACAGAGCAAGAAAAAATCG
CTCGTCCTCGTCGTCCTCGTGGTCGTCCACCGAAGAAAACATCAACTGGCACTGAATG
Atttgcaaaattgcaggtcaataaaacaaacctagtcatttcggtgactaggttttttttgatacttttgtcagattaggttgattgcactacaacatat
ctcgtaaaagaacagttgtagattaaactgcgtattttgctatagacacgtaaacctgattggattaatcgaaaaataaataggATG

    ACIAD0437 Gene: ACIAD0437     GI: 50083689     BI number: ACIAD0437     GOG: -------     Description: putative very-long-chain acyl-CoA synthetas aa a  t at cg gc ta tg tg At Gc Ta |  a |  t |  a       tc |  a      t  g A  a       tg A  a       at Gc        cg Ta        ta C  a       gc A  a       at C  c       ta Gc        cg Gt        cg Ta        at Cg        at At        at             tttttgatacttttgtcagattaggttgattgcactacaacatatctcgtaaaagaacagttgtagattaaactgcgtattttgctatagacacgtaaacctgattggattaatcgaaaaataaataggATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.40 kcal/mol Antiterminator: Size=50 nt.     Delta G=-10.60 kcal/mol Anti-antiterminator:   Size=18 nt.     Delta G= -4.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGTAAAGCTACGGCAAAATCGGCACCTAAAGAGACCAGTACAGAGCAAGAAAAAATCG CTCGTCCTCGTCGTCCTCGTGGTCGTCCACCGAAGAAAACATCAACTGGCACTGAATG Atttgcaaaattgcaggtcaataaaacaaacctagtcatttcggtgactaggttttttttgatacttttgtcagattaggttgattgcactacaacatat ctcgtaaaagaacagttgtagattaaactgcgtattttgctatagacacgtaaacctgattggattaatcgaaaaataaataggATG     ACIAD0437 Gene: ACIAD0437     GI: 50083689     BI number: ACIAD0437     GOG: -------     Description: putative very-long-chain acyl-CoA synthetas            gg           a  t            cc            ga            ta            tt            aa            aa            aa            aa            cc           |  a           |  a           |  a       tc           |  c      t  g           g  c       tg           t  t       at            ta        cg aa        tg        ta a  t      A  t       gc at       G  c       at cg       T  a       ta gc        At        cg ta        At        cg tg        Gt        at tg        Tc        at At        Cg        at                         tttttgatacttttgtcagattaggttgattgcactacaacatatctcgtaaaagaacagttgtagattaaactgcgtattttgctatagacacgtaaacctgattggattaatcgaaaaataaataggATG     ..................................................................................................................