                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:131 nt.    Distance to gene:5 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -8.20 kcal/mol
Antiterminator:    Distance from promoter:86 nt. Size=50 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:    Distance from promoter:53 nt.    Size=43 nt.     Delta G= -5.06 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGATT-TATATT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGATTTAGAACTTGCCGAGCAATATATTGAACTCGGAGCTTATGCTTCTGCCCAAAT
TCTTTTGAATCAAAATGAATCAAAATTTAGCGCTCAACAGCTTGAACTCTCAAAAAAA
CTGCTAAATCGAATGGCATCTTAAaaaatatcgttctaacataagcagtcagtttggactgctttttagttATG

    ACIAD0476 --- truA Gene: ACIAD0476     GI: 50083719     BI number: ACIAD0476     GOG: COG0252     Description: putative L-asparaginase I (AnsA) Gene: truA     GI: 50083718     BI number: ACIAD0474     GOG: COG0101     Description: tRNA-pseudouridine synthase            AA           T  a           T  a CT       C  a A  C       Ta AT        At GC       C  a TA       G  t TA        Gc C  A       Tg G  A       At A  A       At C  A       Gc A  A      |  t A  C      |  a C  |      C  a T  |      T  c C  |      A  a       tt GT       A  t      g  t CG       A  a      a  g GC        Ta        cg AT        Cg        ta TA        Gc        gc TA        Ta        at TA        Cg        cg AT        At        gc                         tttttagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EJ] COG0252 L-asparaginase/archaeal Glu-tRNAGln amidotransferase subunit D ... can be seen here [J] COG0101 Pseudouridylate synthase ... can be seen here     ..................................................................................................................