                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCAGTTGCTTTGGGGTGCTGCTGAGCCGTTACGTCGTATGTTACGTATTCTGATCG
AATACAAAAATGCTTAAacttgattgttaatgatgtcatgaagccgatcttgatgatcggcttttttgtgcatcgacattttaaagac
tgatcatgcgatgtatttgtcggtgttgctcagaaagggtatgacaagaccccaaaaaaccgctaaattacagcttatctaaacactaaaaaatctatgc
gtggaaaacggttaaatctcttagcccgcatcgcacgtggttcaggggaaaactGTG

    ACIAD0477 Gene: ACIAD0477     GI: 50083720     BI number: ACIAD0477     GOG: -------     Description: hypothetical protei aa t  t t  g g  a t  t tg at         g gc       t  a ta       t  t t  t       cg c  g       ta a  |       at A  |       gc A  |       cg Ta        cg Ta        gc Cg        at Gc        at             ttttgtgcatcgacattttaaagactgatcatgcgatgtatttgtcggtgttgctcagaaagggtatgacaagaccccaaaaaaccgctaaattacagcttatctaaacactaaaaaatctatgcgtggaaaacggttaaatctcttagcccgcatcgcacgtggttcaggggaaaactGTG     ..................................................................................................................