                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-20.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGTCGGTTCTGAAACGCCTGAAGGCAAGCAGACCAAATGGAGTCTGGTATATCAGGA
TGGAAAATGGACCGAAGCTTAGgtttttgattctattaaaaatgccgacacattgtgtcggcattttttatgaagctaattttc
tattagatataagatatagatgtttatatttcgataaattctgcaaaaatctagtcatttccacaaaatagtgcaattttaaagcagtttttatacagaa
acttgtgcgatacatgctcacaatagagcagcaattacacattataacgagataaatcATG

    ACIAD0494 --- ACIAD0495 --- ACIAD0496 --- ACIAD0497 Gene: ACIAD0494     GI: 50083733     BI number: ACIAD0494     GOG: COG3247     Description: conserved hypothetical protein; putative membrane protein Gene: ACIAD0495     GI: 50083734     BI number: ACIAD0495     GOG: -------     Description: putative ATP-dependent DNA helicase (PcrA) Gene: ACIAD0496     GI: 50083735     BI number: ACIAD0496     GOG: COG0724     Description: putative RNA-binding protein Gene: ACIAD0497     GI: 50083736     BI number: ACIAD0497     GOG: -------     Description: hypothetical protei            GC           A  T           A  T           G  A            CG            Cg            At            Gt            Gt           |  t           T  t           A  g           A  a            At            At AT        Gc A  G       Gt A  G       Ta C  A       At CG        Gt AT       G  a GC       A  a AT       C  a CG       T  a G  |      A  | A  |       Ta A  |       At CG        Tg         t GT        Gc       a  t |  A       Gc        cg G  T      T  |       at A  A       Cg        cg AT        Ta        at GC        Gc        gc TA       A  a       cg CG       G  |       cg CG        Gc        gc |  A       Ta        ta GT        At        at CG        At        at                         ttttatgaagctaattttctattagatataagatatagatgtttatatttcgataaattctgcaaaaatctagtcatttccacaaaatagtgcaattttaaagcagtttttatacagaaacttgtgcgatacatgctcacaatagagcagcaattacacattataacgagataaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3247 Uncharacterized conserved protein ... can be seen here [R] COG0724 RNA-binding proteins (RRM domain) ... can be seen here     ..................................................................................................................