                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=54 nt.     Delta G= -8.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgcaATGCGTGACAAGATTCGCTTAGTTTCTTCAGCTGGTACTGGTTATTTCTACACTA
CCACGAAGAACAAACGTACTATGCCGGAAAAAATGGAAATCAAAAAATTTGATCCAAA
AATCCGTCAACACGTCATCTTCAAAGAAGCTAAAATCAAATAAttttagattctttaaaaaaacgact
tcaatagaagtcgtttttttttgcattctttttcttcagcttgataaactttcaattattaaaacttggcattttttatgcttgttgttgtaaatcgact
attaaggagtattgaGTG

    ACIAD0500 Gene: ACIAD0500     GI: 50083739     BI number: ACIAD0500     GOG: COG4651     Description: putative transport protein (CPA2 family AA A  T C  A TA At At At At Ta Cg G  a At At Gc At At        at At       a  a |  a       cg |  a       ta C  a       ta T  a       cg T  a       at C  a       gc T  a       cg A  c       at Cg        at Ta        at Gc        at             tttttgcattctttttcttcagcttgataaactttcaattattaaaacttggcattttttatgcttgttgttgtaaatcgactattaaggagtattgaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG4651 Kef-type K+ transport system, predicted NAD-binding component ... can be seen here     ..................................................................................................................