                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.50 kcal/mol
Antiterminator:    Distance from promoter:26 nt. Size=29 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:4 nt.    Size=26 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgaat-cataat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgaataaagtattatgttataacataatttatctcagattaaattgttgataaatgagctgcgattttttcggctgtagtccaatgaaatgatatttat
tgggtttttgatgaagattaacaatctgtaaaaaaacagttgcaaatgaaaacacttctcatttattattgcgttactttaattgtttgaaccgatcagc
taaatcgctcttacactttgcaatgaatatttggttttcaaataggtaattagattcacATG

    ACIAD0507 --- ACIAD0508 --- ACIAD0509 Gene: ACIAD0507     GI: 50083745     BI number: ACIAD0507     GOG: -------     Description: putative TonB Gene: ACIAD0508     GI: 50083746     BI number: ACIAD0508     GOG: -------     Description: putative biopolymer transport protein (ExbB) Gene: ACIAD0509     GI: 50083747     BI number: ACIAD0509     GOG: COG0848     Description: putative biopolymer transport protein (ExbD             t tt       t  t a  g      t  c at       t  g       ga at       t  g      t  t tg       a  c      a  a ta        gt        at at        cg        at |  a       gt        gt |  a       ta        ta g  a       cg        at at       g  t       at cg       a  c       cg ta        gc        cg cg        ta        tg                         tttttgatgaagattaacaatctgtaaaaaaacagttgcaaatgaaaacacttctcatttattattgcgttactttaattgtttgaaccgatcagctaaatcgctcttacactttgcaatgaatatttggttttcaaataggtaattagattcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0848 Biopolymer transport protein ... can be seen here     ..................................................................................................................