Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:138 nt.    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.80 kcal/mol
Antiterminator:    Distance from promoter:109 nt. Size=35 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTT-TATATT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTTTTTCAAGAGACTGTTTATATTGCAATGTCAGGTTTTGGTCAGCAGAAGCACA
GAGCATTTTCGTGGTCGCAACTGCTCCAAAATTGAGCTGATCAGAGCTCAGTTGATAA
CTGCCCATAATACGATTACAACCATCAGAACCACTAAAACGTTTTGTTGCTTGGTCTA
GCTGAAGGCTGGGTTTATTCGTTGCTTTTGGATCAACCTGAAAACCATTAATTTCACT
G

    ACIAD0512


Gene: ACIAD0512     GI: 50083750     BI number: ACIAD0512     GOG: -------     Description: hypothetical protei



  A
T  A
C  A
A  A
C  C
 CG
 AT
 AT
 GT
 AT        CT
 CG       G  G
|  T      A  A
|  T       TA
|  G       CG
|  C       TG
T  T       GC
 AT       G  T
 CG       T  G
 CG        TG
 AT        CG
            TTTATTCGTTGCTTTTGGATCAACCTGAAAACCATTAATTTCACTG


    ..................................................................................................................