                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCAAGCCGTAAGGATATTGGCACTGTCGTGGTGAATGAAGCTGTGATTCGTGGTGAA
GCAGAACCCGAGTACAAGAAAGAGCATACTCAAAAAAAAGATACCCATGAACATAACG
TTGCTGATTTAAAGGTCATTGATTCTAAATCTGCATAAtgtttcattggtctgaaaagcatgatttgcctcg
gcatttcatgctttttttattgcaattgtaaagtgagatgttaatctaaatttgagatacgcatagttttgcgagcaaataattcaaataagacagcgct
tagagggatatcATG

    ACIAD0536 Gene: ACIAD0536     GI: 50083774     BI number: ACIAD0536     GOG: -------     Description: conserved hypothetical protein; putative signal peptid   T A  T CG TA GT GT        gg A  C      t  t A  |      t  c AT        at TA        cg TA        ta TA        ta AT        ta        tc GC       g  a      c  g T  T      t  |       cg CG       A  |       gc GC       A  |       ta TA       T  |      t  t T  T      A  |      t  t G  A       Cg        at C  |       Gc        gc A  |       Ta        ta A  |      |  t       at TA        Cg        cg At        Ta        gc Cg        At        at At        At        at At        At        at Gt        Tg        at                         tttattgcaattgtaaagtgagatgttaatctaaatttgagatacgcatagttttgcgagcaaataattcaaataagacagcgcttagagggatatcATG     ..................................................................................................................