Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.60 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-11.44 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAGGTATGGAAGCTATCTACAAATTTGTAGTCGAAGACATGCCAGTATCCGTTGCAG
TTGATGTTAACGGTACATCGGTACATGCAATTGCACCCAAAATCTGGCAAGAAAAGAT
TGGTAAAATTCCAGTGATTGATGCCACTGCAGTTTAAgcgataaaagcgcctacgggcgcttttttttgccca
aaagtgttaatgtgcacaaacaccacaaaaacacaaaagtaaatcccactcaatccagtagaataagtccgaataattcacaacaacattaatggttaca
gaggctttaccATG

    ACIAD0537


Gene: ACIAD0537     GI: 50083775     BI number: ACIAD0537     GOG: -------     Description: conserved hypothetical protein; putative signal peptid


           GA
  A       T  T
A  G      T  G
C  A      A  C
G  A       GC
G  A       TA
 TA        GC
 CG        AT
 TA        CG
 AT       C  C
 AT        TA
A  |       TG
A  |       AT
C  |       AT
 CG        AT
 CG       A  A
 AT       T  A
C  A      G  g
G  A       Gc
 TA        Tg
 TA        Ta
 AT        At
 AT       G  a
C  C      A  a       ac
 GC       A  a      t  g
 TA       A  a       cg
A  G      A  g       cg
C  T      G  c       gc
A  G      A  |       cg
 TA       A  |       gc
 GT        Cg        at
 GT        Gc        at
 CG        Gc        at
                        tttttgcccaaaagtgttaatgtgcacaaacaccacaaaaacacaaaagtaaatcccactcaatccagtagaataagtccgaataattcacaacaacattaatggttacagaggctttaccATG


    ..................................................................................................................