                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:102 nt.    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-18.60 kcal/mol
Antiterminator:    Distance from promoter:79 nt. Size=38 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:    Distance from promoter:56 nt.    Size=26 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGACT-GAAAAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGACTTTGCAACAAGCATTGACGAAAATGCTGCGCACGGTTCTGACTCTGTAGCATC
TGCTGAGCGTGAAATCGCTTACTTCTTTGCTGCGGACGAAATCTTCCCGCGCACTCGT
TAAttaaaagcatttaaaccagataagtgttattatacttatctggtttttttattctctcttgatgtgattgcttgttttttaggcagtctgatttc
atctcaatttttggtttaggtaattacATG

    ACIAD0557 --- pilF --- ACIAD0560 --- ispG --- hisS --- ACIAD0563 --- ACIAD0564 Gene: ACIAD0557     GI: 50083794     BI number: ACIAD0557     GOG: COG0820     Description: conserved hypothetical protein; putative Fe-S-cluster redox enzyme Gene: pilF     GI: 50083795     BI number: ACIAD0558     GOG: COG3063     Description: type 4 fimbrial biogenesis protein Gene: ACIAD0560     GI: 50083796     BI number: ACIAD0560     GOG: -------     Description: conserved hypothetical protein Gene: ispG     GI: 50083797     BI number: ACIAD0561     GOG: COG0821     Description: 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase Gene: hisS     GI: 50083798     BI number: ACIAD0562     GOG: COG0124     Description: histidyl-tRNA synthetase Gene: ACIAD0563     GI: 50083799     BI number: ACIAD0563     GOG: COG2976     Description: conserved hypothetical protein Gene: ACIAD0564     GI: 50083800     BI number: ACIAD0564     GOG: COG1520     Description: conserved hypothetical protein; putative PQQ enzyme repeat domain protei            gc           a  a            at            at        at            at       t  t            ta        ta   A        ta        gt A  T      |  a       ta A  C      |  c       gc G  T      A  c       at C  T      A  a       at A  C       Tg        ta GC        Ta        at GC       G  t       gc CG       C  a       at GC        Ta        cg T  |       Cg        cg CG        At        at GC        Cg        at TA        Gt        at                         ttttattctctcttgatgtgattgcttgttttttaggcagtctgatttcatctcaatttttggtttaggtaattacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0820 Predicted Fe-S-cluster redox enzyme ... can be seen here [NU] COG3063 Tfp pilus assembly protein PilF ... can be seen here [I] COG0821 Enzyme involved in the deoxyxylulose pathway of isoprenoid biosynthesis ... can be seen here [J] COG0124 Histidyl-tRNA synthetase ... can be seen here [S] COG2976 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG1520 FOG: WD40-like repeat ... can be seen here     ..................................................................................................................