                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=72 nt.     Delta G= -7.21 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCATCTGATTAATCCAGATTCTGGTCAATTGATTGGTCGTGCCAAGACCCGTGGAGAA
GTGAGTTCGCTGCGTGTGGTTGATGGTCATTTATATACATCGACCAGAAAAGGTGCCT
TAACCATCTGGGAAGTGCGTTAAtttttcctcagcttgtgttaaactagccgcttggcgaaacgcttatcaaattcatcgggg
tattttgaatatctagacattcaaaaccccgtatttttatttgggcctctggccttttatcttccttaaatttttcgtttctgatgcagatgccatgaga
gATG

    ACIAD0565 Gene: ACIAD0565     GI: 50083801     BI number: ACIAD0565     GOG: COG1160     Description: putative GTP-binding protein Eng            ct           g  t            cg            cg            gc           a  g           t  a           c  |           a  |           a  |           a  |            ta            ta            gc            tg            gc           |  t           |  t           |  a TT       |  t G  A      |  c C  A      |  a G  t      |  a T  t      |  a Gt       |  t At       t  t       ta At       t  c      c  g Gc       c  a      t  a Gc       g  t      a  c |  t      a  c       ta Gc        cg        at Ta        tg        at Cg        cg        gc |  c       cg        ta T  t      t  t       ta At       t  a       ta Cg       t  t      t  | |  t      t  t      a  | Cg       t  |       ta At        At        gc At        At        gc Ta        Tg        gc Ta        Ta        gc                         gtatttttatttgggcctctggccttttatcttccttaaatttttcgtttctgatgcagatgccatgagagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1160 Predicted GTPases ... can be seen here     ..................................................................................................................