                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=74 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTTAAAACGTCTGAAAATCCATTTGAAGGTCGTAAGTCTCAAGTCGATGAGCGTGTG
GCTGCACGTCGTCGTCGTTATGTGCAAAAATTTAAGAAAGCAGAGAAAAAGTTTAAGC
GTTAAttaccaaattgctaagccccgaaaatgttcggggcttttttatacactgtatttatttttattaaataatatcttaaagaaaataaaacgta
attttttgttaatttaagtactagtggtataatttcgctccaaatttttatgttttgttcatttgattattcaaggcacggtcgagcATG

    ACIAD0566 --- ACIAD0567 --- ACIAD0568 --- ACIAD0569 --- ACIAD0570 --- ACIAD0571 --- ACIAD0572 --- ACIAD0573 --- hutH --- ACIAD0575 Gene: ACIAD0566     GI: 50083802     BI number: ACIAD0566     GOG: NOG06542     Description: conserved hypothetical protein Gene: ACIAD0567     GI: 50083803     BI number: ACIAD0567     GOG: -------     Description: putative acyltransferase Gene: ACIAD0568     GI: 50083804     BI number: ACIAD0568     GOG: -------     Description: putative acyl carrier protein Gene: ACIAD0569     GI: 50083805     BI number: ACIAD0569     GOG: -------     Description: putative acyl carrier protein (ACP) Gene: ACIAD0570     GI: 50083806     BI number: ACIAD0570     GOG: COG4648     Description: conserved hypothetical protein; putative membrane protein Gene: ACIAD0571     GI: 50083807     BI number: ACIAD0571     GOG: -------     Description: conserved hypothetical protein Gene: ACIAD0572     GI: 50083808     BI number: ACIAD0572     GOG: COG4261     Description: conserved hypothetical protein; putative glycosyl transferase (group 2 family protein) Gene: ACIAD0573     GI: 50083809     BI number: ACIAD0573     GOG: COG4261     Description: conserved hypothetical protein Gene: hutH     GI: 50083810     BI number: ACIAD0574     GOG: COG2986     Description: histidine ammonia-lyase protein (Histidase) Gene: ACIAD0575     GI: 50083811     BI number: ACIAD0575     GOG: -------     Description: conserved hypothetical protei   a a  g t  c cc gc tc t  g a  a aa aa |  a c  t c  g a t t A A T T G C G A A T T T         at G        a  g A  |       at A  |       at A        gc A        cg A        cg G         cg A         cg G        gc A        at C        at             ttttatacactgtatttatttttattaaataatatcttaaagaaaataaaacgtaattttttgttaatttaagtactagtggtataatttcgctccaaatttttatgttttgttcatttgattattcaaggcacggtcgagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4648 Predicted membrane protein ... can be seen here [R] COG4261 Predicted acyltransferase ... can be seen here [R] COG4261 Predicted acyltransferase ... can be seen here [E] COG2986 Histidine ammonia-lyase ... can be seen here     ..................................................................................................................