                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTGAAAGTCAGGAAACAAATCGGATTTACCGAATTATTGGTCAGTAGatatttcaattaatt
tttcaacttttagaaaaaccactttgatttggctcaaagtggttttttattatgattcattgagttgttacattaatggatgagttagaagatcattcat
ttgaacttggggtgtttaatgattgcttttttaaggaaaatttgctaaatgtattaaataaattcttgttttgttgttctgttgtttccatttattaatt
tttcttaataataatcaaaatcactgcgaggcgagcATG

    ACIAD0595 --- glnE --- ilvE Gene: ACIAD0595     GI: 50083830     BI number: ACIAD0595     GOG: -------     Description: putative sensory transduction histidine kinase Gene: glnE     GI: 50083831     BI number: ACIAD0596     GOG: COG1391     Description: glutamine synthetase adenylyltransferase Gene: ilvE     GI: 50083832     BI number: ACIAD0597     GOG: COG0115     Description: branched-chain amino acid transferas TT        tt A  A      c  t AT       a  t GT       a  a CG        cg CG        ta AT        ta T  C       ta TA        ta        tg TG        ta       t  g AT       |  c      t  c G  A      a  c       at G  |      a  a       gc CG       t  c       ta Ta       t  t       ta At        at        ta A  a       at        cg A  |       cg        at C  |       ta        cg At       t  t       cg At       t  t       at At        at        at Gc        tg        at                         tttattatgattcattgagttgttacattaatggatgagttagaagatcattcatttgaacttggggtgtttaatgattgcttttttaaggaaaatttgctaaatgtattaaataaattcttgttttgttgttctgttgtttccatttattaatttttcttaataataatcaaaatcactgcgaggcgagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OT] COG1391 Glutamine synthetase adenylyltransferase ... can be seen here [EH] COG0115 Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase ... can be seen here     ..................................................................................................................