Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=75 nt.     Delta G=-15.00 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -7.97 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTGAATATGGGCTTGGCGTATGATGGGCAAATCAATGCCAAAGCAGGTTACCAGCT
TTATGCCAAGGCCAATAATTTGCTCGACAGTAAAGTGTACCTACACGAGTCATTTTTA
TCGGATGTTCCACAGATCGGACGTAATTTTACCATGGGTGTAAACTTTAATTTCTAAt
gagattaagttggaaactatgcaggaaagcttcggctttcctttggtttttataggtcataaaagtcagaattaacgaaatcaatcttgaaaaataagca
gataatctttagcctgaacccagttaTTG

    ACIAD0613


Gene: ACIAD0613     GI: 50083848     BI number: ACIAD0613     GOG: -------     Description: conserved hypothetical protein; putative phospholipase D endonuclease domai


           AA
          T  t
           Cg
           Ta
           Tg
           Ta
           At
           At
          T  |
 AG        Ta
C  A       Ta
A  T       Cg
C  C       At
 CG        At
 TG       A  g
 TA       T  g
 GC       G  a
 TG       T  a
 AT       G  a
G  A       Gc
G  A       Gt
C  T       Ta
T  T       At
A  T       Cg        tc
T  T      |  c      t  g
T  A      C  a       cg
T  C      A  g       gc
T  C       Tg        at
 TA        Ta        at
 AT        Ta        at
 CG        Ta        gc
 TG       A  |       gc
G  |      A  |       at
A  |       Tg       c  t
G  |       Gc       g  |
 CG       C  |      t  |
 AT        At        at
 CG        Gt        tg
 AT        Gc        cg
 TA        Cg        at
                        ttttataggtcataaaagtcagaattaacgaaatcaatcttgaaaaataagcagataatctttagcctgaacccagttaTTG


    ..................................................................................................................