                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTGAATACGTACCTATTGACGATAACGAAGCATTACAAGGCTTCCGTGACCTTACTC
GCATTGAAGGCATTATTCCTGCAATCGAGAGTGCTCATGCAATGGCTTATGTCACCAA
GCTGGCACCTACCATGGACAAAGATCAGATTATCATTGCCAATGTGTCAGGTCGTGGC
GATAAAGACCTAATGACGGTGGCACGTATTGATGGCATCGAGATGGTAGAAATGTAAt
tctaatcatgaacgtgatgtggaaatgggcaacatcaatgtggcccatttttttggagaaagataagcATG

    ACIAD0638 Gene: ACIAD0638     GI: 50083870     BI number: ACIAD0638     GOG: NOG26091     Description: conserved hypothetical protei            aa           g  c            tg            at            cg            ta            at GT       |  g       ca T  A       at       t  a A  A       tg        at At        cg        cg At        ta        at Gc        ta       a  g At       |  a       cg |  a      |  t       gc Ta       A  g       gc Gt       A  g       gc Gc        Tg        ta Ta        Gc        at At        Ta        at                         tttttggagaaagataagcATG     ..................................................................................................................