Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-11.13 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -5.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGTTTAACTGGTGCAGTGACGCATCATGAAGTTGAAGAACAACCAATTGTCTCATC
AGATCATATAGTGCCGCCTTCTAGTCGGAATGCACCTTGTCCATGTGGTTCTGGACTA
AAATATAAGCAATGTCATGGCCGTCTCTAAttcctaggatgctataactgaaaaaagcagaacgtaaatgttctgctt
tttttatgacttttttacgagttgttgcaaggtgcgaataacatttgcagtttagtgcattaagtggtatttacttgcacatgttgacttcaattttggt
aagacaATG

    ACIAD0649


Gene: ACIAD0649     GI: 50083881     BI number: ACIAD0649     GOG: -------     Description: hypothetical protein; putative signal peptid


            t
          t  c
          A  c
           At
           Ta
           Cg
          T  |
           Cg
           Ta
           Gt
          C  |
           Cg
           Gc
           Gt
           Ta
           At
          C  a
           Ta
           Gc
          T  t
  A       A  g
A  A      A  a
T  A      C  a
C  T      G  a
A  A      A  a
G  T      A  a
G  A      T  a
 TA       A  g
 CG       T  |
|  C      A  |
 TA       A  |       aa
 TA       A  |      t  a
 GT       A  |       gt
G  G      T  |       cg
T  T      C  |       at
 GC       A  |       at
 TA       G  |       gc
 AT        Gc        at
 CG        Ta        cg
 CG        Cg        gc
T  C       Ta        at
 GC        Ta        at
 TG        Gc        at
                        ttttatgacttttttacgagttgttgcaaggtgcgaataacatttgcagtttagtgcattaagtggtatttacttgcacatgttgacttcaattttggtaagacaATG


    ..................................................................................................................