Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:74 nt.    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-13.50 kcal/mol
Antiterminator:    Distance from promoter:55 nt. Size=36 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATG-CAAAAT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATGTAGCGCGTAGAACCGTTGCAAAATATCGTGAATCGTTACATATCCCCTCATC
TTCTGAAAGAAAAGTCTTGATCTGAtctgcataatctgtctattctagagattcattgttgcaaaataatgaatcttttttt
tcatcgaaggaatagtttaaatgatttgacgattgcattttatagttaatttctgtctttagatcatttggctatacctttatatcctgatagaagGTG


    ACIAD0658


Gene: ACIAD0658     GI: 50083888     BI number: ACIAD0658     GOG: COG1544     Description: putative sigma(54) modulation protein Rpo



  c
t  t
t  a
a  g       ca
 ta       g  a
 cg        ta
 ta        ta
 gt        gt
t  t       ta
c  c       ta
 ta        at
 at        cg
 at        ta
 tg        ta
|  t       at
 at        gc
 cg        at
 gc        gt
 ta        at
            tttttcatcgaaggaatagtttaaatgatttgacgattgcattttatagttaatttctgtctttagatcatttggctatacctttatatcctgatagaagGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG1544 Ribosome-associated protein Y (PSrp-1) ... can be seen here

    ..................................................................................................................