                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATAGCGAGGTTCAATTGCACGTCGACAAAGCAATACTTTATTGTCCCAAATTGCCAA
GGCACCGCAAATCACTTTAGGATTCTCGTAGTGTATATGACCGCAGTTTGTACATACG
CGGCGTATTTTATGGTCACCTAAAGGAATTTTTTCTTCGGTTTTATGTCCGCAAACGA
TGCAAAAACTCATAATAATCATCAGcgctaaagatagctcagcataaccgaatttttattgtttcgcatcatttgtatacga
cctccagaaaattcagctatgatggaaaaataataaaaaactgaGTG

    ACIAD0674 --- ACIAD0675 Gene: ACIAD0674     GI: 50083903     BI number: ACIAD0674     GOG: COG0494     Description: putative MutT/nudix family protein Gene: ACIAD0675     GI: 50083904     BI number: ACIAD0675     GOG: COG0663     Description: conserved hypothetical protein; putative anhydratas   G T  T G  A AT TA GT CG TA C  | T  | T  | A  |       TA GC       G  C GC       T  A A  G      T  T T  C       TA T  A       GC T  |      A  | C  |       CG A  |       GC C  |       CG TG        CG AT       A  | AT        GC AT        TG CG        AT GT        TA             TTTTATGGTCACCTAAAGGAATTTTTTCTTCGGTTTTATGTCCGCAAACGATGCAAAAACTCATAATAATCATCAGcgctaaagatagctcagcataaccgaatttttattgtttcgcatcatttgtatacgacctccagaaaattcagctatgatggaaaaataataaaaaactgaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here [R] COG0663 Carbonic anhydrases/acetyltransferases, isoleucine patch superfamily ... can be seen here     ..................................................................................................................