                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGATGGTGAGATGGATCTTGGTGATCAATTGTTGCCGTTGGCGCAGCAAATCGCATCA
CGTGTAGTGGTGAAACGTCCAAAACATGCTGTGTTTTTAAATGAACAACAGCCAGATC
ATCAGTGGCAAGGAGATGCCTGTCGTTTCGATGCTTATTTTCAGATTTCTATGTGAgt
atatgtgatcattacttcaatattgattcaatatttgctatatagtggaacagcatcacaaataaaattgcgcttaggaatcttaaaaaaagtgcctact
gaaaaaatgacctcccgaactgctctATG

    ACIAD0681 --- ACIAD0682 Gene: ACIAD0681     GI: 50083908     BI number: ACIAD0681     GOG: -------     Description: conserved hypothetical protein; putative membrane protein Gene: ACIAD0682     GI: 50083909     BI number: ACIAD0682     GOG: COG0627     Description: putative esteras AA T  A T  T TG TA TA GC |  A TA GC TA CG GC |  C |  A |  G |  A |  T |  C                  T |  A                C  G |  T                C  T |  C                 GC |  A                 TG TG                  AT AT                  GT CG                  AT A  G       GA        GC A  C      G  G      G  G A  A      A  A      A  A A  A       AT        AT CG        CG        CG CG        GC        GC TA        GC        GT                         TATTTTCAGATTTCTATGTGAgtatatgtgatcattacttcaatattgattcaatatttgctatatagtggaacagcatcacaaataaaattgcgcttaggaatcttaaaaaaagtgcctactgaaaaaatgacctcccgaactgctctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0627 Predicted esterase ... can be seen here     ..................................................................................................................