                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:201 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtatatggataaactggtgatagaataaacaatgcagcaacaagtgtttatagcgtgatcttttcgcgaataaaaagaatacatgatgtattctttttat
tcgtttaagcgatttaaaaatataatttttatacttctgatgttggattattcgaggtacagtaaaatgaataaaatattgtcagatttggattttgaat
tgccagaattgaatcttgagcattgtcttgaatttagttatgcttaaaaaatacagtaaaaattatttgtgaataacgacaaataatctagatacgaggt
ATG

    ACIAD0686 --- pcoA --- pcoB --- ACIAD0689 Gene: ACIAD0686     GI: 50083913     BI number: ACIAD0686     GOG: -------     Description: hypothetical protein; putative signal peptide Gene: pcoA     GI: 50083914     BI number: ACIAD0687     GOG: COG2132     Description: copper resistance protein A precursor Gene: pcoB     GI: 50083915     BI number: ACIAD0688     GOG: COG3667     Description: copper resistance protein B precursor Gene: ACIAD0689     GI: 50083916     BI number: ACIAD0689     GOG: -------     Description: conserved hypothetical protein; putative membrane protei             t           c  t gc       t  t a  a       at c  a       gc gc        tg ta        gc |  a       cg a  g      |  a at       |  a cg       |  t at       |  a at       g  a at       a  a ta       t  a        g at       a  a      t  a a  a       tg       a  t g  g       ta        cg a  c       ta        at tg        gt        ta at        ta        at g  g       gc        at ta       a  a       gc gt        at        at gc        cg        at                         tttattcgtttaagcgatttaaaaatataatttttatacttctgatgttggattattcgaggtacagtaaaatgaataaaatattgtcagatttggattttgaattgccagaattgaatcttgagcattgtcttgaatttagttatgcttaaaaaatacagtaaaaattatttgtgaataacgacaaataatctagatacgaggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2132 Putative multicopper oxidases ... can be seen here [P] COG3667 Uncharacterized protein involved in copper resistance ... can be seen here     ..................................................................................................................