                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGGTTGTATTCTTAATGGTGAAACTCATTAACCGTATGCGTCGTAAGCAGGAAGAA
GCACCTGCAGCACCAGCACCAACCCCGGAAGATATCGCACTTCTGCGTGAAATTCGTG
ATGAATTAAAAAATCGTCCTCAGGTTTAActgattcatcattaagcggttgcttgtgaaaacggtacgcggtgcgtacc
gtttttttatatgaatcgtttgattctggcatggatttttcttaaaaatttgagattatgaccagcaattaaacacgactgttaaaaatgaaggataagc
tgtagATG

    ACIAD0705 Gene: ACIAD0705     GI: 50083928     BI number: ACIAD0705     GOG: -------     Description: conserved hypothetical protei            aa           g  a            ta            gc           t  |            tg            cg            gt         g            ta       g  t gt       t  |       cg g  t      g  |       gc cg        gc        cg gc        cg        at at        gc        ta at       a  g       gc t  |      a  |       gc tg       t  |       cg at        tg        at cg        at        at ta        cg        at                         ttttatatgaatcgtttgattctggcatggatttttcttaaaaatttgagattatgaccagcaattaaacacgactgttaaaaatgaaggataagctgtagATG     ..................................................................................................................