                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:68 nt.    Distance to gene:127 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-20.00 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=71 nt.     Delta G=-10.19 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGATG-TATATT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGATGGTCTAAATGAGCATGGTTATATTGTGCCTGGACTTGGCGATGCTGGTGACAA
AATTTTTGGTAGTGTCCAAAAAGATTAAttcctaaaaataaaaacaaaagccacaatattgtggcttttgttttttcat
ttcttgattgttaaatatttttataaagatctcttgatactttagtaataataaatactaatattatttataataataattattctcatttattaatgtg
tttgctagaatccctccatctatgggggatgatATG

    ACIAD0745 Gene: ACIAD0745     GI: 50083963     BI number: ACIAD0745     GOG: -------     Description: putative ferric siderophore receptor protei            GT           A  G           T  T            GC            GC            TA            TA            TA            TA            TA           A  G           A  A           A  T           A  T           C  A           A  A           G  t           T  t            Gc CT        Gc C  G      |  t G  G      |  a TA       |  a GC       |  a       ta T  T      |  a      a  t T  |      |  a       at A  |      |  t       cg T  |      |  a       at AT       |  a       cg TG       |  a       cg TG       |  a       gc GC       T  a       at G  G      C  c       at TA       G  a       at AT       T  a       at CG       A  a       cg GC       G  a       at AT        Cg        at G  G       Gc        at TG        Gc        at AT        Ta        at                         tcatttcttgattgttaaatatttttataaagatctcttgatactttagtaataataaatactaatattatttataataataattattctcatttattaatgtgtttgctagaatccctccatctatgggggatgatATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:72 nt.    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.40 kcal/mol Antiterminator:    Distance from promoter:38 nt. Size=71 nt.     Delta G=-10.19 kcal/mol Anti-antiterminator:    Distance from promoter:21 nt.    Size=40 nt.     Delta G= -6.49 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ATGATG-TATATT. It has a score value of 62.92 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATGATGGTCTAAATGAGCATGGTTATATTGTGCCTGGACTTGGCGATGCTGGTGACAA AATTTTTGGTAGTGTCCAAAAAGATTAAttcctaaaaataaaaacaaaagccacaatattgtggcttttgttttttcat ttcttgattgttaaatatttttataaagatctcttgatactttagtaataataaatactaatattatttataataataattattctcatttattaatgtg tttgctagaatccctccatctatgggggatgatATG     ACIAD0745 Gene: ACIAD0745     GI: 50083963     BI number: ACIAD0745     GOG: -------     Description: putative ferric siderophore receptor protei            ta           a  a           a  a            aa            aa            ac            ta            ca            ca            ta           t  g           A  c           A  c           T  a           T  c           A  a           G  a           A  t            Aa            At           | GT       | A  G      | T  T      | GC       | GC       | TA       | TA       |         ta TA       |        a  t TA       |         at TA       |         cg A  G      A         at A  A      A         cg A  T      C         cg A  T      C         gc C  A      T         at A  A      G         at G  t       T        at T  t       G        at Gc        A        cg Gc        T        at                         tttttcatttcttgattgttaaatatttttataaagatctcttgatactttagtaataataaatactaatattatttataataataattattctcatttattaatgtgtttgctagaatccctccatctatgggggatgatATG     ..................................................................................................................