                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:176 nt.    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:161 nt. Size=30 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCTT-TATGAT. It has a score value of 74.3 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTTTGCCTGTAATCTGTTTTATGATTGATGCTGGATGGTATTCACTGGTTGCATT
ACTGCTTTCTTCTGAAAAGCCAAGAACTTTTTACATTAAAGCTAAAACCATGATTGAC
CGTGTGACGGGTGGCATTGTCACAATTTTAGGTTTAAAGCTAATTTTTTCTAGCCGTT
AAttctgacgataccaaattctacactataaaaagtatggattttatctgtacttttttatttaatataaattgaaatagattaaaggatgcatctgag
cataaacgtgctaatCTG

    ACIAD0760 Gene: ACIAD0760     GI: 50083977     BI number: ACIAD0760     GOG: -------     Description: hypothetical protein; putative signal peptid aa t  a        t a  a      t  t ta        ta cg        at at        gc c  a       gt at        tg tg        at cg        ta ta        gc t  t       at at        at at        at at        at             ttatttaatataaattgaaatagattaaaggatgcatctgagcataaacgtgctaatCTG     ..................................................................................................................