Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:45 nt.    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -7.80 kcal/mol
Antiterminator:    Distance from promoter:12 nt. Size=43 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttatat-tataat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttatattttttattagattccttatataatcatgctatctatctgattatttaaattttattgattagtttttttgaacgattggcataaaatttgctaa
ttatttgtttttgaatttaaggataacgaATG

    ACIAD0773


Gene: ACIAD0773     GI: 50083988     BI number: ACIAD0773     GOG: COG0775     Description: putative MTA/SAH nucleosidase [Includes: 5'-methylthioadenosine nucleosidase ; S-adenosylhomocysteine nucleosidase


  t
a  c
t  t
c  a
g  t
t  c
 at         g
 cg       t  a
 ta       t  t
 at        at
 at        ta
 ta        tg
 at       |  t
t  t      |  t        a
 at       t  t      a  a
 ta       t  t      a  t
 ta        at       t  t
c  a       at        at
c  t       at        cg
t  |       tg        gc
t  |       ta        gt
 at        ta        ta
 gt       a  c       ta
 at       t  g       at
 ta        ta       g  t
t  t       at       c  a
 at        gt        at
 tg        tg        at
 ta        cg        gt
                        gtttttgaatttaaggataacgaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG0775 Nucleoside phosphorylase ... can be seen here

    ..................................................................................................................