                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-13.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -6.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtaaaaaccaataaaacgcagcagtcacaattgtcaattctatgtcattaatttcatgtttgtcttttatcaaagtcggtgttagcgcttaaattacaat
cgggacgaagcacatttgacttcatttcgtaaaaggcgtaacgtggcggtaatcaaggttttttatctgtctttgtacactgctatgatgtggtgttaag
ctttttctaagtttctatctgcactatatcaatttgtaatgcattgggttatctgaatatttttaactcagcgtcatctttattatatgatcataggtct
ATG

    ACIAD0774 Gene: ACIAD0774     GI: 50083989     BI number: ACIAD0774     GOG: COG3216     Description: conserved hypothetical protein; putative membrane protei   a a  a a  g tg gc cg |  t |  a       ta t  a      t  t t  c      t  c tg       t  t at       t  g cg       t  t tg        gc |  c       gt        tg tg        at       a  a cg        at       t  t at        cg        cg g  a      t  t       gt t  a      a  a       tg t  t      a  c       cg t  c       ta        at a  a       gc        cg c  a       gt        at a  g       cg       t  t cg        gc       g  | gt        gt       t  | at        ta        ta at        gt        ta gt        cg        cg                         ctttttctaagtttctatctgcactatatcaatttgtaatgcattgggttatctgaatatttttaactcagcgtcatctttattatatgatcataggtctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3216 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................