                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=52 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTGCCGCTGGACATTGTGGTTTTGGTATGGGCGCAACGCCTACTGCCGTTGCAAATA
TGCAAGCAATTACGAATATGTATGGCCCGTCGCATAAAGCATTTTTAATTGTTCCACT
GTGTGGTGCATTTTTTGTTGATTTAATTAATGCGACCGTTATTCAAGTTATTCTTAAG
TTTTTTGTGTAAgactaaaaaactgattgaaagataaactgattcgcaatgtcgataagtaaaaaagtctctagtcacagaggctttttta
tttgttaaatagatttagatagatgccatagcaatATG

    ACIAD0805 Gene: ACIAD0805     GI: 50084019     BI number: ACIAD0805     GOG: COG1115     Description: putative amino-acid transport protei            at           a  g           c  t            gc            cg            ta           t  t           a  a           g  | AA        ta T  g       cg G  a       at T  c      |  a Gt       |  a       tc Ta       |  a      g  a Ta       |  a      a  c Ta       a  a       ta Ta       a  a       cg Ta        tg        ta Ta        at        cg Gc        gc        tg At        at        gc |  g      a  c       at A  a      a  |       at T  t       gt        at T  t       ta        at Cg        tg        at Ta        at        at Ta        gc        ta                         tttgttaaatagatttagatagatgccatagcaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here     ..................................................................................................................