                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:134 nt.    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-13.00 kcal/mol
Antiterminator:    Distance from promoter:107 nt. Size=41 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:    Distance from promoter:72 nt.    Size=50 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATT-TCCATT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATTGCGATCTTGCTACTTACTCCATTTGTACGTTCTTTACTCAAGGATTATCAGC
TACAGTTAAAGAAAGGTATCAAGCAGCCAGAGTTTAAGATTGATCAGCATCCAGAAAT
GAAGAAAAAAGTTGATTCTGATATCTGGTAAttgaatcttattttaaagacagtccgatatacgggctgttttttta
tgacaatttaaataatttcgatacagcttttcacacagcatcagactaaactttgcaaacacaaaaagaacaggttaaaggttttttattgcaATG

    ACIAD0806 Gene: ACIAD0806     GI: 50084020     BI number: ACIAD0806     GOG: COG1752     Description: conserved hypothetical protein; putative esterase of the alpha-beta hydrolase superfamil   G A  T A  T A  G       tt A  A      t  t AT       a  a AT        ta GC        ta AT        cg A  G       ta G  |      a  | TA       a  | AT        gc A  A       ta         a AT        tg       t  t GC        At       a  a AT       A  |       gc CG       T  |       cg CG        Gc        cg T  T       Gc        tg A  A      T  |       gc C  A       Cg        at Gt        Ta        cg At        At        at Cg        Ta        gt Ta        At        at                         ttttatgacaatttaaataatttcgatacagcttttcacacagcatcagactaaactttgcaaacacaaaaagaacaggttaaaggttttttattgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1752 Predicted esterase of the alpha-beta hydrolase superfamily ... can be seen here     ..................................................................................................................