Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=76 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTTCCAAGCTTGGGTCGATCAACTCTGGCTTGAAAAAGATCAACTCATCGGGCAAAT
GAAAGCCAAATACGCCGTTTCATCCTCTTAAgttagccattttaactatgcagaacagttcaaaaaatcagactaaa
tatcatcacctggatccaaatagcttgtcattcaagctatttttgatctatgacatttttatggtctttattattatctttaacctgttctgcttatgtg
ccaacttttttttgatgagcaacataggcagttggttctttgatcatatccgcctaaattttgtcTTG

    ACIAD0896


Gene: ACIAD0896     GI: 50084106     BI number: ACIAD0896     GOG: -------     Description: hypothetical protein; putative membrane protei


 aa
a  a
a  t
a  c
c  a
 tg
 ta
 gc
 at
c  a
a  a
a  a
g  t
a  a
c  t
 gc
 ta
 at
t  c
c  a
a  c
a  c
t  t
 tg
 tg
 ta
 at
|  c
|  c
c  a        a
c  a      c  t
g  a      t  t
 at        gc
 ta        ta
 tg        ta
 gc        cg
 At        gc
 At        at
 Tg        ta
            tttttgatctatgacatttttatggtctttattattatctttaacctgttctgcttatgtgccaacttttttttgatgagcaacataggcagttggttctttgatcatatccgcctaaattttgtcTTG


    ..................................................................................................................