Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:46 nt.    Distance to gene:175 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:17 nt. Size=39 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TATAAT. It has a score value of 78.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGTCTAATCTCAGATTAGTTGTATATAATATTTATGAAGTAATGGCATTGTCTC
CAAAATTATTTATTTTTAATAAGGATATAGTTTTATATCCTTTATTTCCGACATATAT
AATTAGAGTGGGCACACTTATTTAAaaatgaattttttataaagctggaatagattattttgaaaaaaattgattaaattaa
cagaattactaggaaaatccttctctaggggaactttgataagatttccctcataatatccctttgaaaatgaggtcattATG

    ACIAD0951


Gene: ACIAD0951     GI: 50084157     BI number: ACIAD0951     GOG: -------     Description: hypothetical protei


 AT
T  T
T  T
T  T
 AT
 TA
 TA
 AT
A  A
A  A
A  |       TT
 CG       G  T
 CG        AT
 TA        TA
C  T       AT
 TA        TA
 GT        AT
 TA        GC
 TG        GC
 AT        AT
            TTATTTCCGACATATATAATTAGAGTGGGCACACTTATTTAAaaatgaattttttataaagctggaatagattattttgaaaaaaattgattaaattaacagaattactaggaaaatccttctctaggggaactttgataagatttccctcataatatccctttgaaaatgaggtcattATG


    ..................................................................................................................