Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -3.52 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATAAACACACAATCCGTCGTGCAGGCTGATTCAACTGAACGGTATTTCCATCACGATC
TGTTACGCTGATTGAAGAATGCAGTTGTGAATGTACATGATCTTGTGCTGGAGAACAT
CCCGTTTGAATCACTAAGCATAACGTGGTCATTATCAGATAAAAAATATTGGGGCAAT
AACTCAACACataatctcacgccatagaaaactaagaagaccagtaagtcaattaacttatacaatcttgtgtacaagatggtattttattgt
aatttaccacaattgcaacattcggtttttttcATG

    ACIAD0973


Gene: ACIAD0973     GI: 50084177     BI number: ACIAD0973     GOG: -------     Description: putative ferrichrome-iron receptor protei


  A
C  C
A  a
A  t
C  a
T  a
C  t
A  c
A  t
T  c
A  a
A  c
 Cg
 Gc
 Gc
|  a       at
|  t      a  t
|  a      c  a
|  g       ta
|  a       gc
|  a       at
|  a       at
|  a       ta
|  c       gt
|  t      a  a
|  a      c  c       gt
|  a      c  a      t  a
|  g      a  a       gc
|  a      g  |       ta
|  a      a  |       ta
|  g       at        cg
|  a       gc        ta
 Gc        at        at
 Gc        at       a  g
 Ta        tg        cg
 Tg       |  t       at
 At        cg        ta
 Ta        at        at
                        tttattgtaatttaccacaattgcaacattcggtttttttcATG


    ..................................................................................................................